update. ai robot linkslist 2016.

AI ROBOT 2016/I-2

monthly picks jan-jun

neural network-based AI inside weapons

Google Smart Reply has an AI neural network

Google unveils RankBrain AI to handle queries its never seen before | Daily Mail Online

Skynet Lives! Google RankBrain Is A Neural Network Artificial Intelligence Which ‘Loves’ Stephen Hawking And Elon Musk

Facebook reveals plans for artificial intelligence software that can run your life and 'help you understand the world'

Google Smart Reply has an AI neural network

The Orphan I.Q. Dilemma: Brain Plasticity and Environmental Enrichment

Minority Report-style software predicts when and where crimes will take place: System uses web feeds to identify hotspots

Why First Contact is Most Likely to Be Machines -- Artificial Intelligence (A.I.) | Alternative

ConceptNet AI has same IQ as a 4-year-old and is getting smarter

 

things to do. nuclear waste cleanup.

hello and welcome.
despite rumours that the socalled "cabal" might wage nuclear war against russia and china, we should still think about the problems and solutions at hand.
first lets hope some "divine" intervention sends love and wisdom to "them" and second lets look at solutions at hand to fight the dangers of chernobyl and fukushima for us and our children. look at this:

Gomphidius glutinosus

and read this:

How Mushrooms Can Clean Up Radioactive Contamination - An 8 Step Plan

Lifeforms Can Clean Up Radiation

Radiation-hungry fungi could clean up waste

How Mushrooms Can Save the World

Radiation-Loving Fungi Can Remove Toxic Waste

 

i dont know what mr. stamets would think of this, but if you decide for yourself that the risks of  genetic engineering justifies action in the challenge to cleanup, maybe you want to join these people:

 

Gamma Hungry: Nuclear Waste Clean Up With Synthetic Biology - Kickstarter

 

during research about this topic, fungi and radioactive waste, i also found this:

 

New method for cleaning up nuclear waste

 

please read carefully and spread the information.

 

related posts: 

things to come. radiation.

fukushima. update after unit4 explosion.

things to come. cooperation with fungi.

things to come. nuclear waste recycling.

 

ok. cu.

things to come. global cooling.

hello and welcome.
during the last days we had record-breaking temperatures here in germany as well as europewide. but lets not forget that the activity of our sun is low and decreasing and that there are indicators and longterm trends showing we are about to face - global cooling. watch the video and see and believe.

here is some additional videos:

the truth about global warning and the new ice age

think twice.

ok. cu.

milestones. turing-proof artificial intellingence.

hello and welcome.
as we learned today a team of russian scientists managed to design a computerprogram, which successfully mastered a turing test by simulating a thirteen year old boy. congratulations, mr. veselow!

w. veselov, University of Reading

more information here:
en.wikipedia.org/wiki/Turing_test
Turing Test success marks milestone in computing history

Turing Test breakthrough as super-computer becomes first to convince us it's human

and here:
wikipedia.org/wiki/Turing-Test
Computerprogramm "Eugene" besteht Turing-Test

Durchbruch bei Künstlicher Intelligenz. Der unheimlich menschliche Eugene Goostmann

ok cu.

gedichte.

hallo und willkommen.
hier mal ein gedicht von der friedensdemo in dresden.

Gedichtbeitrag auf der Mahnwache für Frieden in Dresden am 02.06.14 from Mahnwache für Frieden - Dresden on Vimeo.

denkt mit.

ok. cu.

gardening. go vertical.

hello and welcome.

have a small garden? think you are not getting much out of it? look at this.

here is the pyramidgarden homepage.

see also the kickstarter offer.

ok. cu.

collaboration. mind over matter.

hello and welcome.
I remember this from years ago, but now as the ukraine and syria and maybe all of eastern europe are raged by war it became an important fact. see the results of the princeton mind-matter interaction research.

applying this to the idea that a small group can change the world brings us to the maharishi-effect.

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World

where there is even proof that a small group of people can change the society. some thinker said that it doesn´t take more than 3.8 million people world wide. think about this.

additional information:

Proof that Group Meditation can Change the World

Proof that Group Meditation can Change the World

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World - See more at: http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World - See more at: http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World - See more at: http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World - See more at: http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World - See more at: http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World - See more at: http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf

Maharishi on “The 1% Effect” – How Just a Small Percentage of People Can Change the World - See more at: http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf

Proof that Group Meditation can Change the World

update on morphic field to come soon.

meditate now.

ok. cu.

fukushima. update after unit4 explosion.

hello and welcome.
here is some update about fukushima. please watch carefully as the mainstream-media do not report about this latest incident.

here is some additional information:
Official in Fukushima: “Please Please HELP US!”

and some assesment by kevin d. blanche:

Fukushima breaking news; the FIGHT IS OVER, WE LOST

nothing ok but cu.

things to come. grounding ourselves.

hello and welcome.
here is what dr. christy westen had to say about grounding ourselves.
see the results.

ok. cu.

things to come. cooperation with fungi.

hello here is a presentation about the use and importance of mushrooms.
enjoy.

heres is more:

“Paul Stamets: Six Ways Mushrooms can Save The World - TED Talks” — Incredible data about mushrooms and why preserving the Old Growth Forest is a... 

“Paul Stamets - The Future is Fungi” — Probably one of the most interesting hour and a half science related lectures... 

“PAUL STAMETS - How Mushrooms Can Help Save the World | Bioneers” — Paul Stamets describes a series of epiphanies around how to shape our world w...  

“Paul Stamets - Solutions from the underground” 

ok. cu.

things to come. nuclear waste recycling.

hello and welcome. 

one of the first priorities in future times will be the recycling of nuclear waste.

we'll update you about fukushima soon.

take care. 

ok. cu.

things to come. natural building.

hello and welcome.

here is some other thing to come.

reorientation. natural building.

ok. cu.

things to come. viruses.

here is a short update on virus and diseases.

Erreger aus Saudi-Arabien USA melden ersten Fall von Mers-Coronavirus

Gefährliches Virus Erster Mers-Fall in USA – Patient flog über London

Infektionskrankheit Gefährliches Mers-Virus erreicht die Niederlande

Likely camel-to-human MERS virus has human-to-human transmission risks

MERS VIRUS HITS USA

Mers-Virus auf dem Vormarsch Gefahr aus der Wüste

Modified measles virus can help destroy cancer cells

Scientists find coronavirus inhibitor blocking MERS and SARS

Sierra Leone Reports 2 Ebola Deaths, 12 Cases

US reports third case of potential MERS virus

Wie gefährlich ist das MERS-Virus wirklich

Wird Kaffee-Ebola freigesetzt, um GMO durchzusetzen

World Health Organization holds emergency meeting on MERS virus

22 U.S. Airports On High Alert By CDC - MERS Virus - CDC Trying To Locate 100 People

Bayern Berliner und Brandenburger Kinder mit Norovirus infiziert

 

stay safe.

ok. cu. 

things to come. parasites.

this video came up while google was searching for morgellons. mabe it is connected to it.

ok. cu.

morgellons. genesequence of a superbug.

here is the link to a video about it.

Morgellons is Silent Superbug, and Fiber Disease

here is the gene sequence from silent superbug.

CBL001 / OPEN SOURCE / ITS SEQUENCE
ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGA
AAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCCC­TGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCG
GGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTTTA
ATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACT­TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAAC­GCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAG­TGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGT­ATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCT­CAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCCCTTGC­GTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTG­GTATAGAAGCGCAGCACAATTTGCGACTCTAGCTAATAAT­TA

CTTGCAACCATCAAGTCTA
CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAG­TCGGCTTTCCTTGTATTATCCAGGCCTATGTCTTACACAT­ACCCCAAAGAATGTAACAGAATGTATTGTATATGGCCTAG­TGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTT­GGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAG­TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG­AACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCT­GTTTGAGTGTCATTAAATTCTCAACCTTATTAGCTTTTGC­TGATAATGGCTTGGACTTGGGGGTCTTTTTGCTGGCTTTC­ATTAGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGC­AGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTG­GACGTCTGCTATAATGGGTTTGCGCTGCTTCTAACCGTCT

­CTCGGGACAACACAAATGACAA

SOURCE: CBS IDENTIFICATION SERVICES (REFERENCE: det 07-138)

here is the link to a video about it.

Morgellons is Silent Superbug, and Fiber Disease

ok. cu.