hier mal ein gedicht von der friedensdemo in dresden.
Gedichtbeitrag auf der Mahnwache für Frieden in Dresden am 02.06.14 from Mahnwache für Frieden - Dresden on Vimeo.
denkt mit.
ok. cu.
07.06.2014
gedichte.
hallo und willkommen.
hier mal ein gedicht von der friedensdemo in dresden.
Gedichtbeitrag auf der Mahnwache für Frieden in Dresden am 02.06.14 from Mahnwache für Frieden - Dresden on Vimeo.
hier mal ein gedicht von der friedensdemo in dresden.
Gedichtbeitrag auf der Mahnwache für Frieden in Dresden am 02.06.14 from Mahnwache für Frieden - Dresden on Vimeo.
06.06.2014
gardening. go vertical.
hello and welcome.
have a small garden? think you are not getting much out of it? look at this.
have a small garden? think you are not getting much out of it? look at this.
ok. cu.
collaboration. mind over matter.
hello and welcome.I remember this from years ago, but now as the ukraine and syria and maybe all of eastern europe are raged by war it became an important fact. see the results of the princeton mind-matter interaction research.
applying this to the idea that a small group can change the world brings us to the maharishi-effect.
where there is even proof that a small group of people can change the society. some thinker said that it doesn´t take more than 3.8 million people world wide. think about this.
additional information:
Proof that Group Meditation can Change the World
Proof that Group Meditation can Change the World
Maharishi
on “The 1% Effect” – How Just a Small Percentage of People Can Change
the World - See more at:
http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf
Maharishi
on “The 1% Effect” – How Just a Small Percentage of People Can Change
the World - See more at:
http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf
Maharishi
on “The 1% Effect” – How Just a Small Percentage of People Can Change
the World - See more at:
http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf
Maharishi
on “The 1% Effect” – How Just a Small Percentage of People Can Change
the World - See more at:
http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf
Maharishi
on “The 1% Effect” – How Just a Small Percentage of People Can Change
the World - See more at:
http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf
Maharishi
on “The 1% Effect” – How Just a Small Percentage of People Can Change
the World - See more at:
http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf
Maharishi
on “The 1% Effect” – How Just a Small Percentage of People Can Change
the World - See more at:
http://www.tm.org/blog/maharishi/maharishi-on-the-1-effect/#sthash.EY0lxnoT.dpuf
update on morphic field to come soon.
meditate now.
ok. cu.
04.06.2014
fukushima. update after unit4 explosion.
hello and welcome.
here is some update about fukushima. please watch carefully as the mainstream-media do not report about this latest incident.
here is some update about fukushima. please watch carefully as the mainstream-media do not report about this latest incident.
here is some additional information:
Official in Fukushima: “Please Please HELP US!”
and some assesment by kevin d. blanche:
nothing ok but cu.
Official in Fukushima: “Please Please HELP US!”
and some assesment by kevin d. blanche:
nothing ok but cu.
things to come. grounding ourselves.
hello and welcome.
here is what dr. christy westen had to say about grounding ourselves.
see the results.
ok. cu.
here is what dr. christy westen had to say about grounding ourselves.
see the results.
ok. cu.
things to come. cooperation with fungi.
hello here is a presentation about the use and importance of mushrooms.
enjoy.
enjoy.
heres is more:
things to come. nuclear waste recycling.
hello and welcome.
one of the first priorities in future times will be the recycling of nuclear waste.
we'll update you about fukushima soon.
take care.
ok. cu.
03.06.2014
things to come. natural building.
hello and welcome.
here is some other thing to come.
here is some other thing to come.
reorientation. natural building.
ok. cu.
02.06.2014
things to come. viruses.
here is a short update on virus and diseases.
- Erreger aus Saudi-Arabien USA melden ersten Fall von Mers-Coronavirus
- Gefährliches Virus Erster Mers-Fall in USA – Patient flog über London
- Infektionskrankheit Gefährliches Mers-Virus erreicht die Niederlande
- Likely camel-to-human MERS virus has human-to-human transmission risks
- MERS VIRUS HITS USA
- Mers-Virus auf dem Vormarsch Gefahr aus der Wüste
- Modified measles virus can help destroy cancer cells
- Scientists find coronavirus inhibitor blocking MERS and SARS
- Sierra Leone Reports 2 Ebola Deaths, 12 Cases
- US reports third case of potential MERS virus
- Wie gefährlich ist das MERS-Virus wirklich
- Wird Kaffee-Ebola freigesetzt, um GMO durchzusetzen
- World Health Organization holds emergency meeting on MERS virus
- 22 U.S. Airports On High Alert By CDC - MERS Virus - CDC Trying To Locate 100 People
- Bayern Berliner und Brandenburger Kinder mit Norovirus infiziert
- stay safe.
- ok. cu.
things to come. parasites.
this video came up while google was searching for morgellons. mabe it is connected to it.
ok. cu.
morgellons. genesequence of a superbug.
here is the link to a video about it.
CBL001 / OPEN SOURCE / ITS SEQUENCE
ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGA
AAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCCC
GGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTTTA
ATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACT
CTTGCAACCATCAAGTCTA
CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAG
CCGAGGCAACTCGGTCGGGAGGACTGCTGGCTTTCACGAG
SOURCE: CBS IDENTIFICATION SERVICES (REFERENCE: det 07-138)
here is the link to a video about it.
ok. cu.
31.05.2014
meet jimmy. the open-source research robot.
hello and welcome.
Trossen Robotics is proud to announce the first robot platform to come from the 21st Century Robot Project, Jimmy the Research Humanoid. Jimmy is powered by Intel inside, which provides an extraordinary amount of CPU horsepower on a mobile walking platform. The 21st Century Robot project is the brainchild of Intel's Futurist Brian David Johnson and is the result of the collaboration of developers from USC, Olin College, and Trossen Robotics.
here is some more links tagged robots from our database:
neues aus der welt der synapsen.
wissenschaftlern ist es erstmals gelungen ein komplettes 3D modell einersynapse zu erzeugen. einschliesslich hundertausender proteine an der oberfläche. es erscheint rätselhaft, wie sich psychiater und pharmaindustrie an einem solchen wunderwerk vergreifen konnten. die ungeheure zahl an selbstmorden unter us-veteranen, die solche medikamente genommen hatten zeigt, dass sich die pharmaindustrie samt ihrer hilfs- und pseudowissenschaft psychiatrie weit vom ziel entfernt haben, den menschen zu helfen. es zeugt von einer erheblichen arroganz und gleichgültigkeit der beteiligten, einschliesslich der behandelnden ärzte den patienten gegenüber. jedem der die zahlen kennt muss klar sein, dass diese leurte andre medikamente brauchen.
ok. cu.
30.05.2014
links. sex and sexes.
- sex and sexes.
- All In The (Robotic) Family New Robots Aim to Manipulate Your Emotions
- Calling Girls Fat May Make Them Obese
- Deadly Contraceptive Depo-Provera Targeted for Minority Women
- Diskriminierungsvorwurf Gleichstellungsbeauftragte klagt gegen Frauenministerium
- Feindbild Mutterglück – warum Muttersein und Emanzipation kein Widerspruch ist
- Four in ten teenage girls 'are addicted to internet' Youngsters increasingly showing signs of compulsion with their tablets
- Frauen - Babys im Sand ertränkt und keinen interessiert’s… The 50 Million Missing Campaign 50 Millionen verschwunden
- Frauen gehören gehört
- Frauen öfter auf Zweitjob angewiesen als Männer
- Frauenkampftag
29.05.2014
info.knowledge transfer.
here is a presentation about
knowledge transfer.
stay tuned for more.
--
videos knowledge management.
during downtime we have compiled a
list of videos
fitting into the discussion.
we welcome you back.
ok. cu.
list of videos
fitting into the discussion.
we welcome you back.
ok. cu.
16.03.2014
3D. printing an amsterdam canalhouse.
hello and welcome. here is some good news for housing. and for recycling.
stay tuned for more.
--
12.03.2014
11.03.2014
info. videos knowledgemanagement.
km
- An Introduction to Knowledge Management von myfebruary142010 24.127 Aufrufe
- Collaboration Effect A Cisco Knowledge Management Overview von Pepperdine University 1.096 Aufrufe
- COMPLEXITY SCIENCE INSIGHTS FOR MANAGERS by Jon Whitty von Jon Whitty 604 Aufrufe
- Connie Crosby (Knowlege Management Strategy) von TheCommonsInstituet 99 Aufrufe
- Dave Snowden Tacit Knowledge State of the Net 2012 von State of the Net 3.516 Aufrufe
- How to Create Innovative Knowledge Management Solutions von Find the Edge 1.313 Aufrufe
- Internet Foodsharing Lebensmittel teilen statt wegwerfen
- Intro to Knowledge Management Tools and Concepts von burnthqTube 1.091 Aufrufe
- JD Edwards Knowledge Transfer von jdetips 458 Aufrufe
- Knowledge Centered Support KCS Knowledge Management Framework - Chapter 1 - Part 1 von Paul Jay 746 Aufrufe
- Knowledge Management on the Battlefield Considerations for the Dept. of Defense's Expanding Role von Pepperdine University 2
- Knowledge Management Strategy vision, purpose and value generation in an era of social learning von Jose Carlos Tenorio Fave
- Knowledge Management Using Enterprise Wiki, Collaboration and Social Media Absolutely! von AHG, Inc. 1.285 Aufrufe
- Knowledge Management von psychedelicyam 6.366 Aufrufe
- Knowledge Management Week 4 von mkling1313 496 Aufrufe
- Knowledge Plaza the Social Knowledge Management app von Knowledge Plaza 336 Aufrufe
- Knowledge Retention & Transfer Air Force Knowledge Now von Pepperdine University 476 Aufrufe
- Knowledge Transfer and Innovation Presentation von NIHRtv 193 Aufrufe
- Managing knowledge spaghetti - John Bessant von somersetfilm 1.012 Aufrufe
- Methods and Tools for Knowledge Transfer in a Multigenerational Workforce von Pepperdine University 1.120 Aufrufe
- More pedagogic change in 10 years than last 1000 years Donald Clark at TEDxGlasgow von TEDx Talks 14.018 Aufrufe
- New Approach to Change Introducing Knowledge Management and Organizational Design von REMAXSELECTPROP 556 Aufrufe
- Open Text A Technology View von Pepperdine University 926 Aufrufe
- Smart Workforce of the Future A One Year Study of the Changing Nature of Work Over the Next Decade von Pepperdine University
- Social Networking and Knowledge Management What's Emerging from Pandora's Box von Pepperdine University 612 Aufrufe
- Social Networking What Does It Mean for Knowledge Management von APQC 860 Aufrufe
- Staying Focused on Talent Management Continuing the Investment for Sustainability von Pepperdine University 645 Aufrufe
- TEDxKC - Michael Wesch - From Knowledgeable to Knowledge-Able von TEDx Talks 56.832 Aufrufe
- Terry Irwin Designer & Educator
- The future of Knowledge Management von K3CubedLtd 3.384 Aufrufe
- Three Eras of Knowledge Management - Nancy Dixon von Nancy Dixon 1.802 Aufrufe
- Transferring Knowledge from Academic to Industry von scgchannel 160 Aufrufe
- Transferring Knowledge to the Next Generation Key Remarks from Dave Licher von Pepperdine University 233 Aufrufe
- Transforming data into knowledge PIM and knowledge management von Newforma 1.779 Aufrufe
- Webinar Nonlinear Project Management for the Rest of Us! von TheBrain Technologies 3.234 Aufrufe
- What is Grand Strategy von UChannel 14.441 Aufrufe
- Why does Knowledge Management exist The K3-Cubed Blog
- ▶ Knowledge Management An organisation's weapon of choice - YouTube
- 11 - Knowledge Management von nptelhrd 7.378 Aufrufe
- linxbox. .all .information .aggregated
10.03.2014
info. the history of knowledge management.
hello and welcome.
here is a short presetation about
the history of knowledge management.
here is a short presetation about
the history of knowledge management.
stay tuned for more...
--
info. knowledge management in times of social media.
hello and welcome.
knowledge management in times of social media.
stay tuned for more.
--
info. knowledge management and social networking.
hello and welcome.
knowledge management and social networking.
stay tuned.
--
knowledge management and social networking.
stay tuned.
--
info. knowledgemanagement. vision, purpose, value.
Knowledge Management Strategy
vision, purpose and value generation
in an era of social learning
by Jose Carlos Tenorio Fave
stay tuned for more.
--
vision, purpose and value generation
in an era of social learning
by Jose Carlos Tenorio Fave
stay tuned for more.
--
Abonnieren
Posts (Atom)